Spliceman Home Page


Select the species/assembly, then enter your DNA sequences in the box below. Click "process sequences" to analyze your input data. This tool uses annotations from the RefSeq Genes track of UCSC Table Browser.

Input Format:


1. [Sequences]


>name
[5 flanking nucleotides (wildtype allele/mutant allele) 5 flanking nucleotides]

Example:
>seq1
agcta(a/c)gatcg
>seq2
ttttc(g/t)aaagg
>seq3
atttagctattcgaagatt(c/g)gagacgtagctaggatcgatcgatctatcgat

Note: FASTA format required. One mutation per line. Letter case is ignored. The minimum flanking sequences of each side of the mutation are 5 nucleotides. The order of wildtype and mutant alleles is not important.

Spliceman Input Form


Species:*

Input sequences:*


Additional options:
  Reverse complement
  Masked splice sites positions


 

* Required